Desain Primer dan Analisis in Silico untuk Amplifikasi Gen mt-Co1  pada Tikus got (Rattus norvegicus)

Maria A E D Sihotang; Yola Eka Erwinda; Eniek Suwarni; Erita Lusianti

doi:10.54384/eruditio.v1i2.82

Penulis

Maria A E D Sihotang Pusat Pengembangan Pengujian Obat dan Makanan Nasional, Badan POM
Yola Eka Erwinda
Eniek Suwarni Pusat Pengembangan Pengujian Obat dan Makanan Nasional, Badan POM
Erita Lusianti Pusat Pengembangan Pengujian Obat dan Makanan Nasional, Badan POM

DOI:

https://doi.org/10.54384/eruditio.v1i2.82

Kata Kunci:

real-time PCR, in silico, primer, probe, detection, Rattus novergicus, mt-Co1, Primer3Plus

Abstrak

Daging tikus got (Rattus norvegicus) merupakan salah satu bahan yang kadang-kadang digunakan untuk campuran bakso sapi dan pangan olahan lain untuk menekan harga produksi. Hal ini sangat merugikan konsumen, baik dari segi kesehatan maupun kehalalan produk pangan. Untuk mencegah terjadinya hal tersebut, pengembangan metode uji untuk mendeteksi daging tikus got dalam pangan olahan sangat diperlukan. Salah satu metode yang mudah dan cepat dalam mengidentifikasi daging tikus got dalam pangan olahan adalah metode Polymerase Chain Reaction (PCR). Pengembangan metode endpoint PCR telah dilakukan, namun metode tersebut masih memiliki beberapa kekurangan dari segi spesifisitas dan kecepatan dalam perolehan hasil. pengembangan metode deteksi daging tikus got dengan metode real-time PCR perlu dikombinasikan dengan TaqMan probe yang lebih sensitif dan spesifik, sehingga dapat menjadi alternatif untuk pendeteksian daging tikus got dalam pangan olahan. Desain primer dan probe merupakan langkah awal dalam pengembangan metode deteksi dengan real-time PCR. Penelitian ini bertujuan mendesain primer dan probe untuk deteksi gen mt-Co1 pada tikus got lalu dianalisis in silico. Sekuens gen mt-Co1 Rattus norvegicus (NC_001665.2) diperoleh dari pangkalan data National Center of Biotechnology Information (NCBI). Primer didesain menggunakan perangkat lunak Primer3Plus. Selanjutnya, beberapa kandidat primer dan probe dianalisis spesifisitasnya terhadap gen mt-CoI secara in silico menggunakan beberapa perangkat lunak, antara lain Primer-BLAST dan Nucleotide-BLAST. Primer dan probe yang spesifik terhadap gen mt-CoI pada tikus got (Rattus norvegicus) berhasil dikonstruksi dengan sekuens primer forward ATGAGCAAAAGCCCACTTTG; sekuen primer reverse CGGCCGTAAGTGAGATGAAT; dan probe GCAGGGATACCTCGTCGTTA. Primer dan probe ini dapat dimanfaatkan untuk pengembangan metode deteksi daging tikus pada bakso atau pangan olahan lain menggunakan real-time PCR dan TaqMan probe.

Unduhan

Data unduhan tidak tersedia.

Referensi

Ahamad, M. N. U., Ali, M. E., Hossain, M. A. M., Asing, A., Sultana, S., & Jahurul, M. H. A. (2017).

Multiplex PCR assay discriminates rabbit, rat and squirrel meat in food chain. Food Additives and Contaminants - Part A Chemistry, Analysis, Control, Exposure and Risk Assessment, 34(12), 2043–2057.

Akimkin, V., Beer, M., Blome, S., Hanke, D., Hoper, D., Jenckel, M., & Pohlmann, A. (2016). New chimeric porcine coronavirus in swine feces, Germany, 2012. Emerging Infectious Diseases, 22(7), 1314–1315. doi: 10.3201/eid2207.160179

Ali, M. E., Razzak, M. A., Hamid, S. B. A., Rahman, M. M., Amin, M. Al, Rashid, N. R. A., & Asing. (2015). Multiplex PCR assay for the detection of five meat species forbidden in Islamic foods. Food Chemistry, 177, 214–224.

Borah, P. (2011). Primer designing for PCR. Science Vision, 11(3), 134–136.

Bobrov, A. G., Kirillina, O., Vadyvaloo, V., Koestler, B. J., Hinz, A. K., Mack, D., … Perry, R. D. (2015). The Yersinia pestis HmsCDE regulatory system is essential for blockage of the oriental rat flea (Xenopsylla cheopis), a classic plague vector. Environmental Microbiology, 17(4), 947–959. doi: 10.1111/1462-2920.12419

Bustin, S., & Huggett, J. (2017). qPCR primer design revisited. Biomolecular Detection and Quantification, 14(November), 19–28.

Cahyadi, M., Wibowo, T., Pramono, A., & Abdurrahman, Z. H. (2020). A novel multiplex-pcr assay to detect three non-halal meats contained in meatball using mitochondrial 12s rrna gene. Food Science of Animal Resources, 40(4), 628–635.

Centers for Disease Control and Prevention. (2017). Diseases directly transmitted by rodents. https://www.cdc.gov/rodents/diseases/direct.html

Chen, X., Ran, D., Zeng, L., Xin, M., (2020). Immunoassay of cooked wild rat meat by ELISA with a highly specific antibody targeting rat heat-resistant proteins. Food and Agricultural Immunology, 31 (1), https://doi.org/10.1080/09540105.2020.1740180

Debode, F., Marien, A., Janssen, É., Bragard, C., & Berben, G. (2017). The influence of amplicon length on real-time PCR results Frédéric.pdf. 21(1), 3–11.

Estalilla, O. C., Medeiros, L. J., Manning, J. T., & Luthra, R. (2000). 5’ → 3’ Exonuclease-based real-time PCR assays for detecting the t(14;18)(q32;21): A survey of 162 malignant lymphomas and reactive specimens. Modern Pathology, 13(6), 661–666.

Geller, J., Meyer, C., Parker, M., & Hawk, H. (2013). Redesign of PCR primers for mitochondrial cytochrome c oxidase subunit I for marine invertebrates and application in all-taxa biotic surveys. Molecular Ecology Resources, 13(5), 851–861.

Herrero, B., Madriñán, M., Vieites, J. M., & Espiñeira, M. (2010). Authentication of atlantic cod (Gadus morhua) Using real time PCR. Journal of Agricultural and Food Chemistry, 58(8), 4794–4799.

Holm, W. Van, Ghesquière, J., Boon, N., Verspecht, T., Bernaerts, K., Zayed, N., Chatzigiannidou, I., & Teughels, W. (2021). A Viability Quantitative PCR Dilemma: Are Longer Amplicons Better? Applied and Environmental Microbiology, 87(5), 1–11.

Hung, J. H., & Weng, Z. (2016). Designing polymerase chain reaction primers using Primer3Plus. Cold Spring Harbor Protocols, 2016(9), 821–826.

Kerfeld, C. A., & Scott, K. M. (2011). Using BLAST to teach “E-value-tionary” concepts. PLoS Biology, 9(2), 1–4. https://doi.org/10.1371/journal.pbio.1001014

Lorenz, T. C. (2012). Polymerase chain reaction: Basic protocol plus troubleshooting and optimization strategies. Journal of Visualized Experiments, 63, 1–15.

Newell, P. D., Fricker, A. D., Roco, C. A., Chandrangsu, P., & Merkel, S. M. (2013). A Small-Group Activity Introducing the Use and Interpretation of BLAST. Journal of Microbiology & Biology Education, 14(2), 238–243.

Nuraini, H., Primasari, A., Andreas, E., & Sumantri, C. (2012). The use of cytochrome b gene as a specific marker of the rat meat (Rattus norvegicus) on meat and meat products. Media Peternakan, 35(1), 15–20.

Purcell, R. V., Pearson, J., Frizelle, F. A., & Keenan, J. I. (2016). Comparison of standard, quantitative and digital PCR in the detection of enterotoxigenic Bacteroides fragilis. Scientific Reports, 6(September), 1–8.

Rodrigues, M. S., Morelli, K. A., & Jansen, A. M. (2017). Cytochrome c oxidase subunit 1 gene as a DNA barcode for discriminating Trypanosoma cruzi DTUs and closely related species. Parasites and Vectors, 10(1), 1–18.

Rodríguez-Lázaro, D., Cook, N., & Hernández, M. (2013). Real-time PCR in food science: PCR diagnostics. Current Issues in Molecular Biology, 15(2), 39–44.

Rodríguez, A., Rodríguez, M., Córdoba, J. J., & Andrade, M. J. (2015). Design of Primers and Probes for Quantitative Real-Time PCR Methods. Methods in Molecular Biology (Clifton, N.J.), 1275, vii.

Roswiem, A. P., & Septiani, T. (2018). Identifikasi Daging Tikus Pada Produk Baso Dengan Metode Sodium Dodecyl Sulphate Polyacrylamide Gel Electrophoresis (SDS-PAGE). Jurnal Kedokteran YARSI, 26(2), 058–065.

Saraswati, H., Seprianto, S., & Dwi Wahyuni, F. (2019). Desain Primer Secara In Silico untuk Amplifikasi Gen cryIII dari Bacillus thuringiensis Isolat Lokal. Indonesian Journal of Biotechnology and Biodiversity, 3(1), 33–38.

Shen, Z., Qu, W., Wang, W., Lu, Y., Wu, Y., Li, Z., Hang, X., Wang, X., Zhao, D., & Zhang, C. (2010). MPprimer: A program for reliable multiplex PCR primer design. BMC Bioinformatics, 11.

Su, Y., Wang, S., Guo, J., Xue, B., Xu, L., & Que, Y. (2013). A TaqMan real-time PCR assay for detection and quantification of sporisorium scitamineum in sugarcane. The Scientific World Journal, 2013.

Suparman, S. (2016). Desain Primer PCR Secara In Silico Untuk Amplifikasi Gen COI Pada Kupu-Kupu Papilio ulysses Linnaeus Dari Pulau Bacan. Jurnal Pendidikan Matematika Dan IPA, 7(1), 14.

Timón-Gómez, A., Nývltová, E., Abriata, L. A., Vila, A. J., Hosler, J., & Barrientos, A. (2018). Mitochondrial Cytochrome c Oxidase Biogenesis: Recent Developments. Physiology & Behavior, 176(3), 139–148.

Tobe, S. S., Kitchener, A., & Linacre, A. (2009). Cytochrome b or cytochrome c oxidase subunit I for mammalian species identification-An answer to the debate. Forensic Science International: Genetics Supplement Series, 2(1), 306–307.

VanGuilder, H. D., Vrana, K. E., & Freeman, W. M. (2008). Twenty-five years of quantitative PCR for gene expression analysis. BioTechniques, 44(5), 619–626.

Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., & Madden, T. L. (2012). Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics, 13(134).